Dataset for CDS BAD of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6SJL0_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
F6SJL0_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
                   ************************************************************

F6SJL0_BAD-01      ggcctgagccccagcaccgcaggggacaggcccccaggctctggcaagcatcgacgccag
F6SJL0_BAD-02      ggcctgagccccagcaccgcaggggacaggcccccaggctctggcaagcatcgacgccag
                   ************************************************************

F6SJL0_BAD-01      gccccaggcctcccgggggacgccagtcaccagcagggacagtcaaccagcagcagccac
F6SJL0_BAD-02      gccccaggcctcccgggggacgccagtcaccagcagggacagtcaaccagcagcagccac
                   ************************************************************

F6SJL0_BAD-01      ca----------------------------------------------------------
F6SJL0_BAD-02      catggagagaatcccagtgtaaggatgttctcgaaagcatcagcagggatgtccgcccca
                   **                                                          

F6SJL0_BAD-01      ----------------------------------------tggaggcgctggggctgtgg
F6SJL0_BAD-02      gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggggctgtgg
                                                           ********************

F6SJL0_BAD-01      agacccggagtcgccacagctcgtaccccgcagggacggaggaggacgaagggatggagg
F6SJL0_BAD-02      agacccggagtcgccacagctcgtaccccgcagggacggaggaggacgaagggatggagg
                   ************************************************************

F6SJL0_BAD-01      aggagcccagcccctttcggggccgttcgcgctcggcaccccccaacctctgggcagcac
F6SJL0_BAD-02      aggagcccagcccctttcggggccgttcgcgctcggcaccccccaacctctgggcagcac
                   ************************************************************

F6SJL0_BAD-01      agcgctatggccgcgagctccggaggatgagtgatgagtttgtggactcctttaagaagg
F6SJL0_BAD-02      agcgctatggccgcgagctccggaggatga------------------------------
                   ******************************                              

F6SJL0_BAD-01      gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagctgga
F6SJL0_BAD-02      ------------------------------------------------------------
                                                                               

F6SJL0_BAD-01      cgcgagtcatccagtcctggtgggataggaacttgggcaggggaggctccgctccttccc
F6SJL0_BAD-02      ------------------------------------------------------------
                                                                               

F6SJL0_BAD-01      agtga
F6SJL0_BAD-02      -----
                        

© 1998-2018