Dataset for CDS classical BH3-containing proteins of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q2YDF0_BCL2L11-02      --------------------------------------------------
Q2YDF0_BCL2L11-03      --------------------------------------------------
Q2YDF0_BCL2L11-01      atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccagg
Q05KI3_BMF-02          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
                                                                         

Q2YDF0_BCL2L11-02      ----------------------------------------------atgg
Q2YDF0_BCL2L11-03      ----------------------------------------------atgg
Q2YDF0_BCL2L11-01      agccggcttgggggaccttgctcccattcggagaaaaaaagaccaaatgg
Q05KI3_BMF-02          ----------------------------------------------atgg
Q05KI3_BMF-01          ----------------------------------------------atgg
F1MUT9_BAD-01          ----------------------------------------------atgt
Q3SYZ0_BAD-01          ----------------------------------------------atgt
                                                                     *** 

Q2YDF0_BCL2L11-02      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggaca-
Q2YDF0_BCL2L11-03      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggaca-
Q2YDF0_BCL2L11-01      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggaca-
Q05KI3_BMF-02          ----------agcc-ac-----cccagtgtgtggaggagctggaggatga
Q05KI3_BMF-01          ----------agcc-ac-----cccagtgtgtggaggagctggaggatga
F1MUT9_BAD-01          ----------tccagat-----cccagagt-ttgagcagagtgagcagga
Q3SYZ0_BAD-01          ----------tccagat-----cccagagt-ttgagcagagtgagcagga
                                   *  *        * * ** *     **   * * *   

Q2YDF0_BCL2L11-02      ---attgcagcct-gccgagaggcctcctcagctcagacct----ggg--
Q2YDF0_BCL2L11-03      ---attgcagcct-gccgagaggcctcctcagctcagacct----ggg--
Q2YDF0_BCL2L11-01      ---attgcagcct-gccgagaggcctcctcagctcagacct----ggg--
Q05KI3_BMF-02          cgtattccagccc-gaggatggggagccggggacccagccc----aggag
Q05KI3_BMF-01          cgtattccagccc-gaggatggggagccggggacccagccc----aggag
F1MUT9_BAD-01          ag-actccagccctgcagataggg-gcctgggccccagccccacagggga
Q3SYZ0_BAD-01          ag-actccagccgtgcagataggg-gcctgggccccagccccacagggga
                          * * *****  *  **  **   **   *  *   **      **  

Q2YDF0_BCL2L11-02      ---gcccccacct-------ctttacagacagagcggcaaggtaatcctg
Q2YDF0_BCL2L11-03      ---gcccccacct-------ctttacagacagagcggca-----------
Q2YDF0_BCL2L11-01      ---gcccccacct-------ctttacagacagagcggca-----------
Q05KI3_BMF-02          cttgctctctgctgacctgtttgcccagagccagctgga-----------
Q05KI3_BMF-01          cttgctctctgctgacctgtttgcccagagccagctgga-----------
F1MUT9_BAD-01          caggcccccaggt----------ctcagcaagcactggc-----------
Q3SYZ0_BAD-01          caggcccccaggt----------ctcagcaagcactggc-----------
                          ** * *   *            ***      * *             

Q2YDF0_BCL2L11-02      aaggagaaggggaccgctgcccccaaggcagcccacagggcccgctggcc
Q2YDF0_BCL2L11-03      --------------------------------------------------
Q2YDF0_BCL2L11-01      --------------------------------------------------
Q05KI3_BMF-02          --------------ctgccccctcagccgtct-----gcagctcttccct
Q05KI3_BMF-01          --------------ctgccccctcagccgtct-----gcagctcttccct
F1MUT9_BAD-01          --------------taacagccccaggcctcctgggggaagctggtcacc
Q3SYZ0_BAD-01          --------------taacagccccaggcctcctgggggaagctggtcacc
                                                                         

Q2YDF0_BCL2L11-02      ccaccggccagccctggccctttcgctaccagatccccgctcttcatctt
Q2YDF0_BCL2L11-03      --------------------------------------------------
Q2YDF0_BCL2L11-01      --------------------------------------------------
Q05KI3_BMF-02          ctcacgcactgctgtggccct-----------------------------
Q05KI3_BMF-01          ctcacgcactgctgtggccct-----------------------------
F1MUT9_BAD-01          agcaggggcagc--cggcc-------------------------------
Q3SYZ0_BAD-01          agcaggggcagc--cggcc-------------------------------
                                                                         

Q2YDF0_BCL2L11-02      cgtgagaagatcctccttgctgtctcgatcctccagtgggtatttctctt
Q2YDF0_BCL2L11-03      --------------------------------------------------
Q2YDF0_BCL2L11-01      --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
                                                                         

Q2YDF0_BCL2L11-02      ttgacacagacaggagcccggcacccatgagttgtgaca---aatccaca
Q2YDF0_BCL2L11-03      -------agacaggagcccggcacccatgagttgtgaca---aatccaca
Q2YDF0_BCL2L11-01      -------agacaggagcccggcacccatgagttgtgaca---aatccaca
Q05KI3_BMF-02          -------gggcttcgacccaccagccaggaa----gaca---aggctacc
Q05KI3_BMF-01          -------gggcttcgacccaccagccaggaa----gaca---aggctacc
F1MUT9_BAD-01          --------ggcagcagcc-----accatgga----ggcactggggctgtg
Q3SYZ0_BAD-01          --------ggcagcagcc-----accatgga----ggcactggggctgtg
                               * *     **      *** *      * **      *    

Q2YDF0_BCL2L11-02      cagaccc----------caagccctcc------ttgccaggc--------
Q2YDF0_BCL2L11-03      cagaccc----------caagccctcc------ttgccaggc--------
Q2YDF0_BCL2L11-01      cagaccc----------caagccctcc------ttgccaggc--------
Q05KI3_BMF-02          cagactc----tcagcccagcttcccc------gagccagggtgtcatgc
Q05KI3_BMF-01          cagactc----tcagcccagcttcccc------gagccagggtgtcatgc
F1MUT9_BAD-01          gagacccggagtcgtcacagctcctaccgcgcggggccagaggataa---
Q3SYZ0_BAD-01          gagacccggagtcgtcacagctcctaccgcgcggggccagaggataa---
                        **** *          **    *  *        *****          

Q2YDF0_BCL2L11-02      ----------------------------cttcaaccattatctcagtgca
Q2YDF0_BCL2L11-03      ----------------------------cttcaaccattatctcagtgca
Q2YDF0_BCL2L11-01      ----------------------------cttcaaccattatctcagtgca
Q05KI3_BMF-02          tgccttgtggggtgactgaggag-----ccccagcgactcttttatggcc
Q05KI3_BMF-01          tgccttgtggggtgactgaggag-----ccccagcgactcttttatggcc
F1MUT9_BAD-01          -------tgaagagacggaggaggaggatctcggc--ccctttaggggcc
Q3SYZ0_BAD-01          -------tgaagagacggaggaggaggatctcggc--ccctttaggggcc
                                                      *  *     * *    ** 

Q2YDF0_BCL2L11-02      at----------ggcttccat-----------------------------
Q2YDF0_BCL2L11-03      at----------ggcttccat-----------------------------
Q2YDF0_BCL2L11-01      at----------ggcttccat-----------------------------
Q05KI3_BMF-02          atgctggctaccggctcccccttcctgccagtttccctgcaggcttgccc
Q05KI3_BMF-01          atgctggctaccggctcccccttcctgccagtttccctgcaggcttgccc
F1MUT9_BAD-01          --gctcgcgttcggcgccccc-----------------------------
Q3SYZ0_BAD-01          --gctcgcgttcggcgccccc-----------------------------
                                   ***  **                               

Q2YDF0_BCL2L11-02      -----gaggcagtctc-----aggctgtacctgcagatacacgcccagag
Q2YDF0_BCL2L11-03      -----gaggcagtctc-----aggctgtacctgcagatacacgcccagag
Q2YDF0_BCL2L11-01      -----gaggcagtctc-----aggctgtacctgcagatacacgcccagag
Q05KI3_BMF-02          cttggtgagcagccccctgaagggcagtggcaacat-----cgagcagag
Q05KI3_BMF-01          cttggtgagcagccccctgaagggcagtggcaacat-----cgagcagag
F1MUT9_BAD-01          ---------caacctct----gggc----------------tgcacagcg
Q3SYZ0_BAD-01          ---------caacctct----gggc----------------tgcacagcg
                                **  * *      ***                 *  *** *

Q2YDF0_BCL2L11-02      atatggattgcccaagagctacggcgtatcggagacgagtttaatgcata
Q2YDF0_BCL2L11-03      atatggattgcccaagagctacggcgtatcggagacgagtttaatgcata
Q2YDF0_BCL2L11-01      atatggattgcccaagagctacggcgtatcggagacgagtttaatgcata
Q05KI3_BMF-02          atacagattgcccgaaaactccagtgcattgcagaccagttcca--tcgg
Q05KI3_BMF-01          atacagattgcccgaaaactccagtgcattgcagaccagttcca--tcgg
F1MUT9_BAD-01          ata-----tggccgcgagctccggaggatgagcgacgagtttcacgtctc
Q3SYZ0_BAD-01          ata-----tggccgcgaactccggaggatgagcgacgagtttcacgtctc
                       ***     ** **   * ** * * * **    *** ****  *      

Q2YDF0_BCL2L11-02      ttac-------------ccaagaagggtcttcgtgcgtcaccaggcagtt
Q2YDF0_BCL2L11-03      ttac-------------ccaagaagggtcttcgtgcgtcaccaggcagtt
Q2YDF0_BCL2L11-01      ttac-------------ccaagaagggtcttcgtgcgtcaccaggcagtt
Q05KI3_BMF-02          cttc-atatgcagcaataccagcagaac-------cgaaatc-gcatgtg
Q05KI3_BMF-01          cttc-atatgcagcaataccagcagaac-------cgaaatc-gcatgtg
F1MUT9_BAD-01          cttcaaggggcttcctcgcccgaagagcgcgggcacggcaac-gcaaat-
Q3SYZ0_BAD-01          cttcaaggggcttcctcgcccgaagagcgcgggcacggcaac-ggaaat-
                        * *              *  * **          **  * * *    * 

Q2YDF0_BCL2L11-02      gagggccacccgcaaatgg----tcctcttgcgcgtcttgcgctacatcg
Q2YDF0_BCL2L11-03      gagggccacccgcaaatgg----tcctcttgcgcgtcttgcgctacatcg
Q2YDF0_BCL2L11-01      gagggccacccgcaaatgg----tcctcttgcgcgtcttgcgctacatcg
Q05KI3_BMF-02          gtggcagatcctc---------ctcttcctacacaacgtggctttgaatg
Q05KI3_BMF-01          gtggcagatcctc---------ctcttcctacacaacgtggctttgaatg
F1MUT9_BAD-01          gcgacaaagccccagctggacgcgcttcctcca-gtcctggttgagccgg
Q3SYZ0_BAD-01          gcgacaaagccccagctggacgcgcttcctcca-gtcctggttgagccgg
                       * *    * ** *           * ** * *    * **         *

Q2YDF0_BCL2L11-02      tgcgtctggtgtggaggatg----------cagtga
Q2YDF0_BCL2L11-03      tgcgtctggtgtggaggatg----------cagtga
Q2YDF0_BCL2L11-01      tgcgtctggtgtggaggatg----------cagtga
Q05KI3_BMF-02          gagatgagaacagga-acggggcaggccccaggtga
Q05KI3_BMF-01          gagatgagaacagga-acggggcaggccccaggtga
F1MUT9_BAD-01          aacttggggagaggaggctccgccccctcccagtga
Q3SYZ0_BAD-01          aacttggggagaggaggctccgccccctcccagtga
                           *  *    ***                 ****

© 1998-2019