Dataset for CDS classical BH3-containing proteins of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccagg
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
                                                                          

A0A3Q1NFP6_PMAIP1-      ----------------------------------------------at--
Q2YDF0_BCL2L11-02       ----------------------------------------------atgg
Q2YDF0_BCL2L11-03       ----------------------------------------------atgg
Q2YDF0_BCL2L11-01       agccggcttgggggaccttgctcccattcggagaaaaaaagaccaaatgg
A0A3Q1LXZ6_BBC3-01      ----------------------------------------------atgg
Q05KI3_BMF-01           ----------------------------------------------atgg
Q05KI3_BMF-02           ----------------------------------------------atgg
F1MUT9_BAD-01           ----------------------------------------------atgt
Q3SYZ0_BAD-01           ----------------------------------------------atgt
                                                                      **  

A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
Q2YDF0_BCL2L11-02       caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
Q2YDF0_BCL2L11-03       caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
Q2YDF0_BCL2L11-01       caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A3Q1LXZ6_BBC3-01      cccgagcacgccag----gag-----ggcagctccccggagcccgtagag
Q05KI3_BMF-01           agcc---accccagtgtgtgg-----aggagct----ggaggatgacgta
Q05KI3_BMF-02           agcc---accccagtgtgtgg-----aggagct----ggaggatgacgta
F1MUT9_BAD-01           tccag--atcccagagt-ttg-----agcagag----tgagcaggaag-a
Q3SYZ0_BAD-01           tccag--atcccagagt-ttg-----agcagag----tgagcaggaag-a
                                                                          

A0A3Q1NFP6_PMAIP1-      -----gcct-ggaaggagggctcgtaa-----------gagcgcccagcc
Q2YDF0_BCL2L11-02       ttgcagcct-gccgagaggcctcctcagctcagacctggggcccccacct
Q2YDF0_BCL2L11-03       ttgcagcct-gccgagaggcctcctcagctcagacctggggcccccacct
Q2YDF0_BCL2L11-01       ttgcagcct-gccgagaggcctcctcagctcagacctggggcccccacct
A0A3Q1LXZ6_BBC3-01      ggcctggcccgc-----gacggccc-------------gcgccccttccc
Q05KI3_BMF-01           ttccagccc-gaggatggggagccg-------------gggacccagccc
Q05KI3_BMF-02           ttccagccc-gaggatggggagccg-------------gggacccagccc
F1MUT9_BAD-01           ctccagccctgcagataggg-gcct-------------gggccccagccc
Q3SYZ0_BAD-01           ctccagccgtgcagataggg-gcct-------------gggccccagccc
                             * *  *      *    *               * *  **   * 

A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
Q2YDF0_BCL2L11-02       ctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgc
Q2YDF0_BCL2L11-03       ctttacagacagagcggca-------------------------------
Q2YDF0_BCL2L11-01       ctttacagacagagcggca-------------------------------
A0A3Q1LXZ6_BBC3-01      gctcagccgcctggtgccc-------------------------------
Q05KI3_BMF-01           ----aggagcttg-----c-------------------------------
Q05KI3_BMF-02           ----aggagcttg-----c-------------------------------
F1MUT9_BAD-01           cacaggggacagg-----c-------------------------------
Q3SYZ0_BAD-01           cacaggggacagg-----c-------------------------------
                                                                          

A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
Q2YDF0_BCL2L11-02       ccccaaggcagcccacagggcccgctggccccaccggccagccctggccc
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      ---------------------------------------tcggcggtgtc
Q05KI3_BMF-01           ---------------------------------------tctctgctgac
Q05KI3_BMF-02           ---------------------------------------tctctgctgac
F1MUT9_BAD-01           ---------------------------------------ccccaggt---
Q3SYZ0_BAD-01           ---------------------------------------ccccaggt---
                                                                          

A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
Q2YDF0_BCL2L11-02       tttcgctaccagatccccgctcttcatcttcgtgagaagatcctccttgc
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      ctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccc
Q05KI3_BMF-01           ctgtttgcccagagcca---gctggactgccccctcagccgtct------
Q05KI3_BMF-02           ctgtttgcccagagcca---gctggactgccccctcagccgtct------
F1MUT9_BAD-01           -------ctcagcaagc---actggctaacagccccaggcctcctgg--g
Q3SYZ0_BAD-01           -------ctcagcaagc---actggctaacagccccaggcctcctgg--g
                                                                          

A0A3Q1NFP6_PMAIP1-      -------------------------------------------gagcc--
Q2YDF0_BCL2L11-02       tgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccg
Q2YDF0_BCL2L11-03       -------------------------------------agacaggagcccg
Q2YDF0_BCL2L11-01       -------------------------------------agacaggagcccg
A0A3Q1LXZ6_BBC3-01      tgctgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcacc
Q05KI3_BMF-01           -gcagctcttccctctc--acgcactgctgtggccctgggcttcgaccca
Q05KI3_BMF-02           -gcagctcttccctctc--acgcactgctgtggccctgggcttcgaccca
F1MUT9_BAD-01           ggaagctggtcaccagc--aggggcagc--cggcc---ggcagcagcc--
Q3SYZ0_BAD-01           ggaagctggtcaccagc--aggggcagc--cggcc---ggcagcagcc--
                                                                      *   

A0A3Q1NFP6_PMAIP1-      -------------------------ccacgcgggtccc------------
Q2YDF0_BCL2L11-02       gcacccatgag---ttgtgacaaatccacacagaccccaagccctccttg
Q2YDF0_BCL2L11-03       gcacccatgag---ttgtgacaaatccacacagaccccaagccctccttg
Q2YDF0_BCL2L11-01       gcacccatgag---ttgtgacaaatccacacagaccccaagccctccttg
A0A3Q1LXZ6_BBC3-01      gccgccctgggggccccccgctggcctgggggtccccgcagccggccccg
Q05KI3_BMF-01           ccagccaggaagaca-------aggctacccagactc----tcagcccag
Q05KI3_BMF-02           ccagccaggaagaca-------aggctacccagactc----tcagcccag
F1MUT9_BAD-01           ---accatggaggcac----tggggctgtggagacccggagtcgtcacag
Q3SYZ0_BAD-01           ---accatggaggcac----tggggctgtggagacccggagtcgtcacag
                                                 *          *             

A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------ccaggccttcaaccattatctcagtgcaat
Q2YDF0_BCL2L11-03       --------------------ccaggccttcaaccattatctcagtgcaat
Q2YDF0_BCL2L11-01       --------------------ccaggccttcaaccattatctcagtgcaat
A0A3Q1LXZ6_BBC3-01      aggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagc
Q05KI3_BMF-01           ----cttcccc------gagccagggtgtcatgctgccttgtggggtgac
Q05KI3_BMF-02           ----cttcccc------gagccagggtgtcatgctgccttgtggggtgac
F1MUT9_BAD-01           ----ctcctaccgcgcggggccagaggataa----------tgaagagac
Q3SYZ0_BAD-01           ----ctcctaccgcgcggggccagaggataa----------tgaagagac
                                                                          

A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      acctggaatcaccagtgcccagcgcccc---gggggcc---ctggcgggc
Q05KI3_BMF-01           ----tgaggag-----ccccagcgactcttttatggccatgctggctacc
Q05KI3_BMF-02           ----tgaggag-----ccccagcgactcttttatggccatgctggctacc
F1MUT9_BAD-01           ----ggaggaggaggatctcggc--ccctttaggggcc--gctcgcgttc
Q3SYZ0_BAD-01           ----ggaggaggaggatctcggc--ccctttaggggcc--gctcgcgttc
                                                                          

A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
Q2YDF0_BCL2L11-02       ggcttccat----------------------------------gaggcag
Q2YDF0_BCL2L11-03       ggcttccat----------------------------------gaggcag
Q2YDF0_BCL2L11-01       ggcttccat----------------------------------gaggcag
A0A3Q1LXZ6_BBC3-01      ggccccacc----------------------------------caagcgg
Q05KI3_BMF-01           ggctcccccttcctgccagtttccctgcaggcttgccccttggtgagcag
Q05KI3_BMF-02           ggctcccccttcctgccagtttccctgcaggcttgccccttggtgagcag
F1MUT9_BAD-01           ggcgccccc--------------------------------------caa
Q3SYZ0_BAD-01           ggcgccccc--------------------------------------caa
                                                                          

A0A3Q1NFP6_PMAIP1-      -----ggcagatcctgaagttgaatg---------------tgccattc-
Q2YDF0_BCL2L11-02       tctcaggctgtacctgcagatacacgcccagagatatggattgcccaag-
Q2YDF0_BCL2L11-03       tctcaggctgtacctgcagatacacgcccagagatatggattgcccaag-
Q2YDF0_BCL2L11-01       tctcaggctgtacctgcagatacacgcccagagatatggattgcccaag-
A0A3Q1LXZ6_BBC3-01      cccc--gggagtccggggggaggaggagcagtgggcccgagagatcgggg
Q05KI3_BMF-01           ccccctgaagggcagtggcaacatcgagcagagatacagattgcccgaa-
Q05KI3_BMF-02           ccccctgaagggcagtggcaacatcgagcagagatacagattgcccgaa-
F1MUT9_BAD-01           cctct----gggc-----------tgcacagcgata-----tggccgcg-
Q3SYZ0_BAD-01           cctct----gggc-----------tgcacagcgata-----tggccgcg-
                                    *            *                *       

A0A3Q1NFP6_PMAIP1-      ---agttgaggagaattggagacaaactgaat------------------
Q2YDF0_BCL2L11-02       ---agctacggcgtatcggagacgagtttaatgcatattacccaagaagg
Q2YDF0_BCL2L11-03       ---agctacggcgtatcggagacgagtttaatgcatattacccaagaagg
Q2YDF0_BCL2L11-01       ---agctacggcgtatcggagacgagtttaatgcatattacccaagaagg
A0A3Q1LXZ6_BBC3-01      cccagctgcggcggatggcggacgacctcaacgcgcta------------
Q05KI3_BMF-01           ---aactccagtgcattgcagaccagttcca--tcggc------------
Q05KI3_BMF-02           ---aactccagtgcattgcagaccagttcca--tcggc------------
F1MUT9_BAD-01           ---agctccggaggatgagcgacgagtttcacgtctcc------------
Q3SYZ0_BAD-01           ---aactccggaggatgagcgacgagtttcacgtctcc------------
                           *  *   * * **    *** *  *  *                   

A0A3Q1NFP6_PMAIP1-      ---ttc------cggcagaaacttgtgaat-------ctgatatccaaa-
Q2YDF0_BCL2L11-02       gtcttcgtgcgtcaccaggcagttgagggc-------c--acccgcaaat
Q2YDF0_BCL2L11-03       gtcttcgtgcgtcaccaggcagttgagggc-------c--acccgcaaat
Q2YDF0_BCL2L11-01       gtcttcgtgcgtcaccaggcagttgagggc-------c--acccgcaaat
A0A3Q1LXZ6_BBC3-01      ---tacgagcggcggagacaagaggag----------cggca--------
Q05KI3_BMF-01           ---ttc-atatgcagcaataccagcagaac-------cgaaatcgcatgt
Q05KI3_BMF-02           ---ttc-atatgcagcaataccagcagaac-------cgaaatcgcatgt
F1MUT9_BAD-01           ---ttcaaggggcttcctcgcccgaagagcgcgggcacggcaacgcaaat
Q3SYZ0_BAD-01           ---ttcaaggggcttcctcgcccgaagagcgcgggcacggcaacggaaat
                           * *      *             *          *            

A0A3Q1NFP6_PMAIP1-      --------ctcctc---------cgc-tcaggaact--------------
Q2YDF0_BCL2L11-02       ggt----cctcttg---------cgcgtcttgcgctacatcgtgcgtctg
Q2YDF0_BCL2L11-03       ggt----cctcttg---------cgcgtcttgcgctacatcgtgcgtctg
Q2YDF0_BCL2L11-01       ggt----cctcttg---------cgcgtcttgcgctacatcgtgcgtctg
A0A3Q1LXZ6_BBC3-01      -gcgacaccgccc----------ctcaccctggagggtcctgtacaatct
Q05KI3_BMF-01           ggtggcagatcctc---------ctcttcctacacaacgtggctttgaat
Q05KI3_BMF-02           ggtggcagatcctc---------ctcttcctacacaacgtggctttgaat
F1MUT9_BAD-01           -gcgacaaagccccagctggacgcgcttcctcca-gtcctggttgagccg
Q3SYZ0_BAD-01           -gcgacaaagccccagctggacgcgcttcctcca-gtcctggttgagccg
                                  *            * *  *                     

A0A3Q1NFP6_PMAIP1-      -----------------------------------------------tga
Q2YDF0_BCL2L11-02       gtgtggagga--------------------------------tgcagtga
Q2YDF0_BCL2L11-03       gtgtggagga--------------------------------tgcagtga
Q2YDF0_BCL2L11-01       gtgtggagga--------------------------------tgcagtga
A0A3Q1LXZ6_BBC3-01      catcatgggactcctgccctttcccgggggccgcggagcccccgaggtgg
Q05KI3_BMF-01           ggagatgaga-------------acagga-acggggcaggccccaggtga
Q05KI3_BMF-02           ggagatgaga-------------acagga-acggggcaggccccaggtga
F1MUT9_BAD-01           gaacttgggg-------------agaggaggctccgccccctcccagtga
Q3SYZ0_BAD-01           gaacttgggg-------------agaggaggctccgccccctcccagtga
                                                                       ** 

A0A3Q1NFP6_PMAIP1-      -----------
Q2YDF0_BCL2L11-02       -----------
Q2YDF0_BCL2L11-03       -----------
Q2YDF0_BCL2L11-01       -----------
A0A3Q1LXZ6_BBC3-01      agcccaattag
Q05KI3_BMF-01           -----------
Q05KI3_BMF-02           -----------
F1MUT9_BAD-01           -----------
Q3SYZ0_BAD-01           -----------
                                   

© 1998-2019