Dataset for CDS classical BH3-containing proteins of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q2YDF0_BCL2L11-01      atggcaaagcaaccttccgatgtaagttctgagtgt------gacagaga
G3MWR6_HRK-01          atg-----------------tgcccgtgccccctgc--------------
Q05KI3_BMF-01          atg-----------------gagcc-accccagtgtgtggaggagctgga
F1MUT9_BAD-01          atg-----------------ttccagatcccagagt-ttgagcagagtga
Q3SYZ0_BAD-01          atg-----------------ttccagatcccagagt-ttgagcagagtga
                       ***                         *     *               

Q2YDF0_BCL2L11-01      aggtggacaattgcagcct------------gccgaga----ggcctc--
G3MWR6_HRK-01          -------------------------------accgcggccgcggccc---
Q05KI3_BMF-01          ggatgacgtattccagccc-gaggatggggagccggggacccagccc---
F1MUT9_BAD-01          gcaggaag-actccagccctgcagataggg-gcctgggccccagccccac
Q3SYZ0_BAD-01          gcaggaag-actccagccgtgcagataggg-gcctgggccccagccccac
                                                       **  *      ***    

Q2YDF0_BCL2L11-01      -----------------------------ctcagc----tcagacctggg
G3MWR6_HRK-01          -----------------------------cccggc-cgtgtgcgcctgca
Q05KI3_BMF-01          -aggagcttgctctctgctgacctgtttgcccagagccagctggactgcc
F1MUT9_BAD-01          aggggacaggcccccaggt----------ctcagcaagcactggctaaca
Q3SYZ0_BAD-01          aggggacaggcccccaggt----------ctcagcaagcactggctaaca
                                                    * * *                

Q2YDF0_BCL2L11-01      gcccccacctctt------------------tacagacagagcggcaa--
G3MWR6_HRK-01          gcgccggccgcctgggtctgcgctcgtccgccgcgcagctcacggcagcc
Q05KI3_BMF-01          ccctcagccgtct-----gcagctcttccctctcacgcactgctgtggcc
F1MUT9_BAD-01          gccccaggcctcctgggggaagctggtcaccagcaggggcagc--cggcc
Q3SYZ0_BAD-01          gccccaggcctcctgggggaagctggtcaccagcaggggcagc--cggcc
                        *  *   *                        *        *       

Q2YDF0_BCL2L11-01      ---gacaggagcccggcacccatgagttgtgacaaatccacacagacccc
G3MWR6_HRK-01          c--ggctcaaggcgctcggcgacgagctgcaccagcgc-------accat
Q05KI3_BMF-01          ctgggcttcgacccaccagccaggaa-gaca---aggctacccagactc-
F1MUT9_BAD-01          ---ggcagcagcc-----accatgga-ggcactggggctgtggagacccg
Q3SYZ0_BAD-01          ---ggcagcagcc-----accatgga-ggcactggggctgtggagacccg
                          * *      *      * * *             *       **   

Q2YDF0_BCL2L11-01      aagccctccttgcc-----------aggcc--------------------
G3MWR6_HRK-01          gtggcggcgccgc-------gcgcggagccggagggc-------------
Q05KI3_BMF-01          ---tcagcccagcttcccc------gagccagggtgtcatgctgccttgt
F1MUT9_BAD-01          gagtcgtcacagctcctaccgcgcggggccagaggataa----------t
Q3SYZ0_BAD-01          gagtcgtcacagctcctaccgcgcggggccagaggataa----------t
                           *  *   **              ***                    

Q2YDF0_BCL2L11-01      ---------------------ttcaaccattatctcagtgc---aatggc
G3MWR6_HRK-01          --------------------------------------------gccggc
Q05KI3_BMF-01          ggggtgactgaggag-----ccccagcgactcttttatggccatgctggc
F1MUT9_BAD-01          gaagagacggaggaggaggatctcggc--ccctttaggggcc--gctcgc
Q3SYZ0_BAD-01          gaagagacggaggaggaggatctcggc--ccctttaggggcc--gctcgc

Q2YDF0_BCL2L11-01      ttccatgaggcagtctcaggct----------------------------
G3MWR6_HRK-01          gtcc----ggcgcgctcc--------------------------------
Q05KI3_BMF-01          tacc----ggctcccccttcctgccagtttccctgcaggcttgccccttg
F1MUT9_BAD-01          gttc----ggcgccccc---------------------------------
Q3SYZ0_BAD-01          gttc----ggcgccccc---------------------------------
                          *    ***   * *                                 

Q2YDF0_BCL2L11-01      -----gtacctgcagatacac------------gcccagagatatggatt
G3MWR6_HRK-01          -----ctacctac------------------------------------t
Q05KI3_BMF-01          gtgagcagccccctgaagggcagtggcaacatcgagcagagatacagatt
F1MUT9_BAD-01          -----caacctct----gggc-----------tgcacagcgata-----t
Q3SYZ0_BAD-01          -----caacctct----gggc-----------tgcacagcgata-----t
                               **                                       *

Q2YDF0_BCL2L11-01      gcccaagagctacggcgtatcggagacgagtttaatgcatattacc----
G3MWR6_HRK-01          ggcc----------------------------------------------
Q05KI3_BMF-01          gcccgaaaactccagtgcattgcagaccagttcca--tcggcttc-atat
F1MUT9_BAD-01          ggccgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggg
Q3SYZ0_BAD-01          ggccgcgaactccggaggatgagcgacgagtttcacgtctccttcaaggg
                       * **                                              

Q2YDF0_BCL2L11-01      ---------caagaagggtcttcgtgcgtcaccaggcagttgagggccac
G3MWR6_HRK-01          ---------ctggctgtgcg------cggccgc--gcaggtgg-------
Q05KI3_BMF-01          gcagcaataccagcagaac-------cgaaatc--gcatgtgg-------
F1MUT9_BAD-01          gcttcctcgcccgaagagcgcgggcacggcaac--gcaaat-g-------
Q3SYZ0_BAD-01          gcttcctcgcccgaagagcgcgggcacggcaac--ggaaat-g-------
                                *  *  *          **    *  * *  *         

Q2YDF0_BCL2L11-01      ccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgt--------
G3MWR6_HRK-01          cag------------------cgctggc-----ggcctggctg-------
Q05KI3_BMF-01          tggcagatcctc---------ctcttcctacacaacgtggctttgaatgg
F1MUT9_BAD-01          cgacaaagccccagctggacgcgcttcctcca-gtcctggttgagccgga
Q3SYZ0_BAD-01          cgacaaagccccagctggacgcgcttcctcca-gtcctggttgagccgga
                                              **  *       * **  *        

Q2YDF0_BCL2L11-01      -ctggtgtggagga-------------tgcagtga
G3MWR6_HRK-01          -ctcggcaggcgga-------------acttgtag
Q05KI3_BMF-01          agatgagaacagga-acggggcaggccccaggtga
F1MUT9_BAD-01          acttggggagaggaggctccgccccctcccagtga
Q3SYZ0_BAD-01          acttggggagaggaggctccgccccctcccagtga
                           *      ***                 **  

© 1998-2019