Dataset for CDS BCL2L11 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q2YDF0_BCL2L11-02      --------------------------------------------------
Q2YDF0_BCL2L11-03      --------------------------------------------------
Q2YDF0_BCL2L11-01      atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccagg
                                                                         

Q2YDF0_BCL2L11-02      ----------------------------------------------atgg
Q2YDF0_BCL2L11-03      ----------------------------------------------atgg
Q2YDF0_BCL2L11-01      agccggcttgggggaccttgctcccattcggagaaaaaaagaccaaatgg
                                                                     ****

Q2YDF0_BCL2L11-02      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
Q2YDF0_BCL2L11-03      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
Q2YDF0_BCL2L11-01      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
                       **************************************************

Q2YDF0_BCL2L11-02      ttgcagcctgccgagaggcctcctcagctcagacctggggcccccacctc
Q2YDF0_BCL2L11-03      ttgcagcctgccgagaggcctcctcagctcagacctggggcccccacctc
Q2YDF0_BCL2L11-01      ttgcagcctgccgagaggcctcctcagctcagacctggggcccccacctc
                       **************************************************

Q2YDF0_BCL2L11-02      tttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcc
Q2YDF0_BCL2L11-03      tttacagacagagcggca--------------------------------
Q2YDF0_BCL2L11-01      tttacagacagagcggca--------------------------------
                       ******************                                

Q2YDF0_BCL2L11-02      cccaaggcagcccacagggcccgctggccccaccggccagccctggccct
Q2YDF0_BCL2L11-03      --------------------------------------------------
Q2YDF0_BCL2L11-01      --------------------------------------------------
                                                                         

Q2YDF0_BCL2L11-02      ttcgctaccagatccccgctcttcatcttcgtgagaagatcctccttgct
Q2YDF0_BCL2L11-03      --------------------------------------------------
Q2YDF0_BCL2L11-01      --------------------------------------------------
                                                                         

Q2YDF0_BCL2L11-02      gtctcgatcctccagtgggtatttctcttttgacacagacaggagcccgg
Q2YDF0_BCL2L11-03      ------------------------------------agacaggagcccgg
Q2YDF0_BCL2L11-01      ------------------------------------agacaggagcccgg
                                                           **************

Q2YDF0_BCL2L11-02      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
Q2YDF0_BCL2L11-03      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
Q2YDF0_BCL2L11-01      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
                       **************************************************

Q2YDF0_BCL2L11-02      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
Q2YDF0_BCL2L11-03      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
Q2YDF0_BCL2L11-01      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
                       **************************************************

Q2YDF0_BCL2L11-02      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
Q2YDF0_BCL2L11-03      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
Q2YDF0_BCL2L11-01      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
                       **************************************************

Q2YDF0_BCL2L11-02      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
Q2YDF0_BCL2L11-03      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
Q2YDF0_BCL2L11-01      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
                       **************************************************

Q2YDF0_BCL2L11-02      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
Q2YDF0_BCL2L11-03      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
Q2YDF0_BCL2L11-01      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
                       **************************************************

Q2YDF0_BCL2L11-02      ctacatcgtgcgtctggtgtggaggatgcagtga
Q2YDF0_BCL2L11-03      ctacatcgtgcgtctggtgtggaggatgcagtga
Q2YDF0_BCL2L11-01      ctacatcgtgcgtctggtgtggaggatgcagtga
                       **********************************

© 1998-2019