Dataset for CDS BAD of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1IH05_BAD-01      atg-----tccacagcggcgagagcggcggcggg-------gacctgcga
A0A3B1JLM2_BAD-01      atgagcaatcagtatctgctaaaactgaggagagctcgttttaattgcga
                       ***     **   * * ** * * * * ** * *        *  *****

A0A3B1IH05_BAD-01      c------------------------------------tccactg------
A0A3B1JLM2_BAD-01      cgaggagggatatagccaagcacttaacagcagaacatcgactgaaggag
                       *                                    ** ****      

A0A3B1IH05_BAD-01      ---------------ctgtcagccagccgtcc--aaactc----------
A0A3B1JLM2_BAD-01      gggggagagatacgcttttcaggccattgtgctggaattcatctggaagc
                                       * **** *    ** *   ** **          

A0A3B1IH05_BAD-01      ---gatttcacaatgg----------atcacat-gttcacaatatctgat
A0A3B1JLM2_BAD-01      acagttttcacaatggaaaagacaccaccacacagtaaagaagatgacat
                          * ***********          * ****  **  * ** **   **

A0A3B1IH05_BAD-01      gagtc----agatgcatctgaagagctaggagactcaga-ccagccagag
A0A3B1JLM2_BAD-01      cagtcccatagatgaccacgatgaatcaaggtggtcagaggcagtcaaga
                        ****    *****     ** **   * *    *****  *** **   

A0A3B1IH05_BAD-01      gt------------cagtaagacagctgagccatcgcggtctgggcagca
A0A3B1JLM2_BAD-01      gtgtcgactccccacagacggacagcgggcccagcatgtacaggg--aca
                       **            ***   ****** *  *** *  *  * ***   **

A0A3B1IH05_BAD-01      catca---------ctgttccggaga--------------------aact
A0A3B1JLM2_BAD-01      catcatcagacgagctgtt--ggaggtggggggtcgagtgaggctctact
                       *****         *****  ****                      ***

A0A3B1IH05_BAD-01      cagagtagagcccaggcaaaggaatttttctatgaatgaagaggctctg-
A0A3B1JLM2_BAD-01      cagagt----cccaagtgtacaa---catcaaccgctgggaggacaatga
                       ******    **** *   *  *     ** *    **    * *  ** 

A0A3B1IH05_BAD-01      ----caggagtctggtgctgggagacacgaagatggagctcgagatggag
A0A3B1JLM2_BAD-01      gaaccagga---tggcgcttcagcagaggacggtggtgtcggtgacggag
                           *****   *** ***     * * ** * *** *   * ** ****

A0A3B1IH05_BAD-01      attcattccgacgccgcagccgctcagctcccccttctctgtgggcagcc
A0A3B1JLM2_BAD-01      caccattccgaggccgatcccagtcagctcctgctgcgctatggaaagcc
                          ******** ****   **  ********  ** * ** ***  ****

A0A3B1IH05_BAD-01      aagaaatatggccgacagctgaggaagatgagtgacgagtttgacaaggg
A0A3B1JLM2_BAD-01      aagaaatatggacggcagttgaggaggatgagcgatgagtttgacacctg
                       *********** ** *** ****** ****** ** **********   *

A0A3B1IH05_BAD-01      gctagagcaaggga--tgaagagggtgaggagtgccggagcagcccgcc-
A0A3B1JLM2_BAD-01      gttggacaaaggggacttaaga--------------agaacaactggccc
                       * * **  *****   * ****               ** ** *  *** 

A0A3B1IH05_BAD-01      --agatgcaaaactcccccagctggtttgcctttctttggagtcacaagg
A0A3B1JLM2_BAD-01      tgggaggcataccaaccgaggatggttctctttcctctggggtaccaaag
                          ** *** * *  **   * *****  * ** ** *** **  *** *

A0A3B1IH05_BAD-01      aatcagactctgaggcgagcagcagccgtccagcagaatga
A0A3B1JLM2_BAD-01      aa---------gaggagggaag------------agaataa
                       **         **** * * **            ***** *

© 1998-2019