Dataset for CDS BAD of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5KIV3_BAD-01      gggggtc--------------------gagtgaggc---tct-------------actca
W5KW69_BAD-01      atggatcacatgttcacaatatctgatgagtcagatgcatctgaagagctaggagactca
                     ** **                    **** **     ***             *****

W5KIV3_BAD-01      gagtcccaagtgtaca---------------------------------acatcaaccgc
W5KW69_BAD-01      gaccagccagaggtcagtaagacagctgagccatcgcggtctgggcagcacatc-actgt
                   **    * ** *  **                                 ***** ** * 

W5KIV3_BAD-01      tgggaggacaatgagaaccaggatggcgcttcagcagag---------------------
W5KW69_BAD-01      tccggagaaactcagaggtgagtcagtgtctaggcaaaggaatttttctatgaatgaaga
                   *  *  ** * * ***     *   * *  *  *** **                     

W5KIV3_BAD-01      -------------------------------gacggtggtgtcggtgacggagcaccatt
W5KW69_BAD-01      ggatctgcaggagtctggtgctgggagacacgaagatggagctcgagatggagattcatt
                                                  ** * *** *   * ** ****   ****

W5KIV3_BAD-01      ccgaggccgatcccagtcagctcctgctgcgctatggaaagccaagaaatatggacggca
W5KW69_BAD-01      ccgacgccgcagccgctcagctcccccttctctgtgggcagccaagaaatatggccgaca
                   **** ****   **  ********  ** * ** ***  *************** ** **

W5KIV3_BAD-01      gttgaggaggatgagcgatgagtttgacacctggttggacaaaggggacttaaga-----
W5KW69_BAD-01      gctgaggaagatgagtgacgagtttgacaaggggctagagcaaggga--tgaagagggtg
                   * ****** ****** ** **********   ** * **  *****   * ****     

W5KIV3_BAD-01      ---------agaacaactggccctgggaggcataccaaccgaggatggttctctttcctc
W5KW69_BAD-01      aggagtgccggagcagcccgcc---agatgcaaaactcccccagctggtttgcctttctt
                             ** ** *  ***    ** *** * *  **   * *****  * ** ** 

W5KIV3_BAD-01      tggggtaccaaagaa---------gaggagggaag------------agaa---
W5KW69_BAD-01      tggagtcacaaggaatcagactctgaggcgagcagcagccgtccagcagaatga
                   *** **  *** ***         **** * * **            ****   

© 1998-2018