Dataset for CDS BMF of organism Astatotilapia calliptera

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8NFE2_BMF-02      atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcg
A0A3P8NFE2_BMF-01      atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcg
                       **************************************************

A0A3P8NFE2_BMF-02      caccacattcagggagataaagtgtgaacatcgaggcacacagacacccg
A0A3P8NFE2_BMF-01      caccacattcagggagataaagtgtgaacatcgaggcacacagacacccg
                       **************************************************

A0A3P8NFE2_BMF-02      gtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagag
A0A3P8NFE2_BMF-01      gtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagag
                       **************************************************

A0A3P8NFE2_BMF-02      gagcccagaccactcttctacggtaacgcaggttttcgattgcacttccc
A0A3P8NFE2_BMF-01      gagcccagaccactcttctacggtaacgcaggttttcgattgcacttccc
                       **************************************************

A0A3P8NFE2_BMF-02      ggcacgcttcgagctcgtcggggatcacagagcgagtcgacaaggaagca
A0A3P8NFE2_BMF-01      ggcacgcttcgagctcgtcggggatcacagagcgagtcgacaaggaagca
                       **************************************************

A0A3P8NFE2_BMF-02      cggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggct
A0A3P8NFE2_BMF-01      cggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggct
                       **************************************************

A0A3P8NFE2_BMF-02      cgcagcgtggaggcctgcattggacagaaactccagctcataggagacca
A0A3P8NFE2_BMF-01      cgcagcgtggaggcctgcattggacagaaactccagctcataggagacca
                       **************************************************

A0A3P8NFE2_BMF-02      gtttcactgggaacgcctgcaactgg-----tgaaagcaagtagaataca
A0A3P8NFE2_BMF-01      gtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
                       *************************       **** ***    *  *  

A0A3P8NFE2_BMF-02      aacatgctggctggaaactgctgaagcttatgcaacaccctgcaaagttc
A0A3P8NFE2_BMF-01      ggccgatgtggtggcgcctg-----gccgcggccattctcagc-------
                         *      * ***   ***     **    ** *  * * **       

A0A3P8NFE2_BMF-02      accacagtgtgataacggtatggaaacccagaggcttatcacagtggcag
A0A3P8NFE2_BMF-01      -cttctgtttgatag-ggggttcatagccggagga----------ggggg
                        *  * ** *****  **  *  * * ** ****           **  *

A0A3P8NFE2_BMF-02      ttcttgactgttaactag
A0A3P8NFE2_BMF-01      tggaggacgg--aggtga
                       *    *** *  *  *  

© 1998-2019