Dataset for CDS classical BH3-containing proteins of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

19 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5CLG5_BIK-01       --------------------------atgtctgaagttagacccctctcc
A0A2K5CFK7_PMAIP1-      --------------------------atgc--------------------
A0A2K5E6K7_BAD-03       --------------------------atgttcca----------------
A0A2K5E6K7_BAD-01       --------------------------atgttcca----------------
A0A2K5E6K7_BAD-02       --------------------------atgttcca----------------
A0A2K5E1W9_BMF-02       --------------------------atgg---a----------------
A0A2K5E1W9_BMF-01       --------------------------atgg---a----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5CAB2_BCL2L11      --------------------------atggcaaa----------------
A0A2K5BYA0_HRK-01       ------------------------atgtgcccgt----------------
A0A2K5F6X4_BBC3-02      aaatgtggcgtggggtctgcctgggcatgtccat----------------

A0A2K5CLG5_BIK-01       agtgacatcttgatggagaccctcttgtgtgagcagttcgtgcatcccct
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       ---------------g--atc-------------ccagagttt-------
A0A2K5E6K7_BAD-01       ---------------g--atc-------------ccagagttt-------
A0A2K5E6K7_BAD-02       ---------------g--atc-------------ccagagttt-------
A0A2K5E1W9_BMF-02       ---------------gccatc-------------tcagtgtgt-------
A0A2K5E1W9_BMF-01       ---------------gccatc-------------tcagtgtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5CAB2_BCL2L11      ---------------gcaaccttccgatgtaagttctgagtgt-------
A0A2K5BYA0_HRK-01       ---------------gccccctgc----------accgcg----------
A0A2K5F6X4_BBC3-02      ---------------gccaagtgc----------ctagggcttcttcctc

A0A2K5CLG5_BIK-01       gaccatggaggttgtcggtgggagtgaccctgaagagga-----------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       gagcc----------------gagtgagcaggaaga--------------
A0A2K5E6K7_BAD-01       gagcc----------------gagtgagcaggaaga--------------
A0A2K5E6K7_BAD-02       gagcc----------------gagtgagcaggaaga--------------
A0A2K5E1W9_BMF-02       ggag---------------------gagctggaggatgatg---------
A0A2K5E1W9_BMF-01       ggag---------------------gagctggaggatgatg---------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5CAB2_BCL2L11      gacc---------------------gagaaggtagacaa-----------
A0A2K5BYA0_HRK-01       gtcgc----------------ggccccccggc------------------
A0A2K5F6X4_BBC3-02      gacgt----------------gggtcccctgccagatgtgtggtcctcag

A0A2K5CLG5_BIK-01       ------cctggaccctgtggaggaccctttggaatgcatggagaacagtg
A0A2K5CFK7_PMAIP1-      --------------ctgggaagaaggcgcgcaagagc-------------
A0A2K5E6K7_BAD-03       ------ctccagctctgcagagagg-------------------------
A0A2K5E6K7_BAD-01       ------ctccagctctgcagagagg-------------------------
A0A2K5E6K7_BAD-02       ------ctccagctctgcagagagg-------------------------
A0A2K5E1W9_BMF-02       ----tgttccagt-cagaggatggggagccagggacc-------------
A0A2K5E1W9_BMF-01       ----tgttccagt-cagaggatggggagccagggacc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5CAB2_BCL2L11      ------ttgcagc-ctgcggagagacctccccagctc-------------
A0A2K5BYA0_HRK-01       ----cgtttgcgc-ctgcagcgcgggt-----------------------
A0A2K5F6X4_BBC3-02      ccctcgctctcgc-tggcggagcag-------------------------

A0A2K5CLG5_BIK-01       acgc-actggtcctgcagctggcctgcatcgcggaccagatggatgtgag
A0A2K5CFK7_PMAIP1-      gcgcaaccgag-cccctcgcgggctcca-------------g--------
A0A2K5E6K7_BAD-03       -ggc--ctgag-ccccagcaccgcaggg-------------ga-------
A0A2K5E6K7_BAD-01       -ggc--ctgag-ccccagcaccgcaggg-------------ga-------
A0A2K5E6K7_BAD-02       -ggc--ctgag-ccccagcaccgcaggg-------------ga-------
A0A2K5E1W9_BMF-02       caac--ccggga--gcttgctctctgct-------------gacctgttt
A0A2K5E1W9_BMF-01       caac--ccggga--gcttgctctctgct-------------gacctgttt
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5CAB2_BCL2L11      agac--ctggggcccctacctccctaca-------------ga-------
A0A2K5BYA0_HRK-01       -cgc--ctggggctgcgctcgtccgccg-------------cg-------
A0A2K5F6X4_BBC3-02      -cac--ctggagtcgcccgtgcccagcg-------------cc-------
                           *  * *      *       *                          

A0A2K5CLG5_BIK-01       ccttagggcccggaggc---------------------------------
A0A2K5CFK7_PMAIP1-      ---cagaccttgaagt----------------------------------
A0A2K5E6K7_BAD-03       ---caggcccccaggct---------------------------------
A0A2K5E6K7_BAD-01       ---caggcccccaggct---------------------------------
A0A2K5E6K7_BAD-02       ---caggcccccaggct---------------------------------
A0A2K5E1W9_BMF-02       gcccagagcc----------------------------------------
A0A2K5E1W9_BMF-01       gcccagagcc----------------------------------------
A0A2K5CAB2_BCL2L11      ---cagagccaca-------------------------------------
A0A2K5CAB2_BCL2L11      ---cagagccaca-------------------------------------
A0A2K5CAB2_BCL2L11      ---cagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggac
A0A2K5CAB2_BCL2L11      ---cagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggac
A0A2K5CAB2_BCL2L11      ---cagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggac
A0A2K5CAB2_BCL2L11      ---cagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggac
A0A2K5CAB2_BCL2L11      ---cagagccaca-------------------------------------
A0A2K5CAB2_BCL2L11      ---cagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggac
A0A2K5CAB2_BCL2L11      ---cagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggac
A0A2K5CAB2_BCL2L11      ---cagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggac
A0A2K5BYA0_HRK-01       ---cag--------------------------------------------
A0A2K5F6X4_BBC3-02      ---ccgggggccctgg----------------------------------

A0A2K5CLG5_BIK-01       --------------------------tggcccagctctatgaggtggcca
A0A2K5CFK7_PMAIP1-      --------------------------cgagtgtgc-----cactcaactc
A0A2K5E6K7_BAD-03       --------------------------ctggcaagcatccacgccaggccc
A0A2K5E6K7_BAD-01       --------------------------ctggcaagcatccacgccaggccc
A0A2K5E6K7_BAD-02       --------------------------ctggcaagcatccacgccaggccc
A0A2K5E1W9_BMF-02       ------------------------tactggactgccccctcagccggctt
A0A2K5E1W9_BMF-01       ------------------------tactggactgccccctcagccggctt
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      agctgcccccacggcagccctcagggcccgctggccccaccggccagccc
A0A2K5CAB2_BCL2L11      agctgcccccacggcagccctcagggcccgctggccccaccggccagccc
A0A2K5CAB2_BCL2L11      agctgcccccacggcagccctcagggcccgctggccccaccggccagccc
A0A2K5CAB2_BCL2L11      agctgcccccacggcagccctcagggcccgctggccccaccggccagccc
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      agctgcccccacggcagccctcagggcccgctggccccaccggccagccc
A0A2K5CAB2_BCL2L11      agctgcccccacggcagccctcagggcccgctggccccaccggccagccc
A0A2K5CAB2_BCL2L11      agctgcccccacggcagccctcagggcccgctggccccaccggccagccc
A0A2K5BYA0_HRK-01       ----------------------------------ctcacc---gccgccc
A0A2K5F6X4_BBC3-02      --------------------------cgggcggtcccacccaggcggccc

A0A2K5CLG5_BIK-01       tgtacagccc-------------------------------gggtctcgc
A0A2K5CFK7_PMAIP1-      agga----------------------------------------------
A0A2K5E6K7_BAD-03       caggcctccc------------------------------aggggacgcc
A0A2K5E6K7_BAD-01       caggcctccc------------------------------aggggacgcc
A0A2K5E6K7_BAD-02       caggcctccc------------------------------aggggacgcc
A0A2K5E1W9_BMF-02       cagctcttcc-----------------------------------ctctc
A0A2K5E1W9_BMF-01       cagctcttcc-----------------------------------ctctc
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      tggcccttttgctaccagatccccgcttttcatctttgtgagaagatcct
A0A2K5CAB2_BCL2L11      tggcccttttgctaccagatccccgcttttcatctttgtgagaagatcct
A0A2K5CAB2_BCL2L11      tggcccttttgctaccagatccccgcttttcatctttgtgagaagatcct
A0A2K5CAB2_BCL2L11      tggcccttttgctaccagatccccgcttttcatctttgtgagaagatcct
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      tggcccttttgctaccagatccccgcttttcatctttgtgagaagatcct
A0A2K5CAB2_BCL2L11      tggcccttttgctaccagatccccgcttttcatctttgtgagaagatcct
A0A2K5CAB2_BCL2L11      tggcccttttgctaccagatccccgcttttcatctttgtgagaagatcct
A0A2K5BYA0_HRK-01       ---------------------------ggctcaaggcgctcggcgacgag
A0A2K5F6X4_BBC3-02      cgggagtccgcggggaggaggagcagtgggcccgggagatcggggcccag

A0A2K5CLG5_BIK-01       tttcatcctc---------------------------------gaccgga
A0A2K5CFK7_PMAIP1-      -------------------------------------------gatttgg
A0A2K5E6K7_BAD-03       agtcaccagcag-------------------------------ggacagc
A0A2K5E6K7_BAD-01       agtcaccagcag-------------------------------ggacagc
A0A2K5E6K7_BAD-02       agtcaccagcag-------------------------------ggacagc
A0A2K5E1W9_BMF-02       acccactgctgtggccct-------------------------ggccttc
A0A2K5E1W9_BMF-01       acccactgctgtggccct-------------------------ggccttc
A0A2K5CAB2_BCL2L11      -------------------------------------------agacagg
A0A2K5CAB2_BCL2L11      -------------------------------------------agacagg
A0A2K5CAB2_BCL2L11      ccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacagg
A0A2K5CAB2_BCL2L11      ccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacagg
A0A2K5CAB2_BCL2L11      ccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacagg
A0A2K5CAB2_BCL2L11      ccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacagg
A0A2K5CAB2_BCL2L11      -------------------------------------------agacagg
A0A2K5CAB2_BCL2L11      ccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacagg
A0A2K5CAB2_BCL2L11      ccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacagg
A0A2K5CAB2_BCL2L11      ccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacagg
A0A2K5BYA0_HRK-01       ctgcacc----------------------------------------agc
A0A2K5F6X4_BBC3-02      ctgcggc------------------------------------ggatggc

A0A2K5CLG5_BIK-01       ccgacatcggggatgttcttag----------------------------
A0A2K5CFK7_PMAIP1-      agacaaactaaatttccggcag----------------------------
A0A2K5E6K7_BAD-03       caaccagcagcagccaccatggaggtgagtactccacttgtgcctctgct
A0A2K5E6K7_BAD-01       caaccagcagcagccaccatggaggcgc----------------------
A0A2K5E6K7_BAD-02       caaccagcagcagccaccatgg----------------------------
A0A2K5E1W9_BMF-02       gacccaccag------ccagga----------------------------
A0A2K5E1W9_BMF-01       gacccaccag------ccagga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5CAB2_BCL2L11      agcccagcac------ccatga----------------------------
A0A2K5BYA0_HRK-01       gcaccatgtggcggcgccgcgc----------------------------
A0A2K5F6X4_BBC3-02      ggacgacctcaacgcgcagtac----------------------------

A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       tcctcatctgagaatcccagtgcaaggatgctctcgaaagcatcagcagg
A0A2K5E6K7_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------

A0A2K5CLG5_BIK-01       -----------------------------------------cggtatcgt
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       gatgtccgccccagccactgactcagaaaatgtaaagctggaggtgcctt
A0A2K5E6K7_BAD-01       --------------------------------tggggctgtggagacc--
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       ---------------------------------------------a----
A0A2K5E1W9_BMF-01       ---------------------------------------------a----
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5CAB2_BCL2L11      ---------------------------------------------gttgt
A0A2K5BYA0_HRK-01       ---------------------------------------------gcgga
A0A2K5F6X4_BBC3-02      ----------------------------------------gagcggcgga

A0A2K5CLG5_BIK-01       ggaagttttcgctaacttcca-----------------------------
A0A2K5CFK7_PMAIP1-      ------------aaacttctg-----------------------------
A0A2K5E6K7_BAD-03       gctgggtcgccacagctcctaccccgcagggacggaggaggacgaaggga
A0A2K5E6K7_BAD-01       -cgaagtcgccacagctcctaccccgcagggacggaggaggacgaaggga
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       gacaaggctacccagaccctc-----------------------------
A0A2K5E1W9_BMF-01       gacaaggctacccagaccctc-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5CAB2_BCL2L11      gacaaatcaacacaaacccca-----------------------------
A0A2K5BYA0_HRK-01       gccggagggcgccagcgcccg-----------------------------
A0A2K5F6X4_BBC3-02      gacaagagg----agcagccg-----------------------------

A0A2K5CLG5_BIK-01       -------------------------------------ggaggacatagtg
A0A2K5CFK7_PMAIP1-      ---------aatc-------------------------------------
A0A2K5E6K7_BAD-03       tggaggaggagcccag---cccctttcggg-----------gccgt---t
A0A2K5E6K7_BAD-01       tggaggaggagcccag---cccctttcggg-----------gccgt---t
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       ---------agcccagcctcccccagccaaggtgtcatgctgccttgtgg
A0A2K5E1W9_BMF-01       ---------agcccagcctcccccagccaaggtgtcatgctgccttgtgg
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5CAB2_BCL2L11      ---------agtc------ctccttgccag-----------gcctt----
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------

A0A2K5CLG5_BIK-01       aggctctggagatccctgagctcc----------gggtcctgggtgt---
A0A2K5CFK7_PMAIP1-      ---------tgatatccaaactct--------------------------
A0A2K5E6K7_BAD-03       cgcgctcagcaccccccaacctctgggcagcacagcgctatggccgc---
A0A2K5E6K7_BAD-01       cgcgctcagcaccccccaacctctgggcagcacagcgctatggccgc---
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       ggtgactgaggaaccccagcgact----cttttacg--------------
A0A2K5E1W9_BMF-01       ggtgactgaggaaccccagcgact----cttttacggcaatgctggctat
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatgggtga---
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatggatga---
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatggtt-----
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaat---------
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatggcttc---
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatggcttc---
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatggcttc---
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatggcttc---
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatggcttc---
A0A2K5CAB2_BCL2L11      ----------------caaccact----atctcagtgcaatggct-----
A0A2K5BYA0_HRK-01       ------gcgcgctccccacctact-----------ggccctggctgt---
A0A2K5F6X4_BBC3-02      ------cagcaccgccc-----ct-----------caccctggaggg---

A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       cggcttcctctccctgccagtttcccagcagtcttgccccttggggagca
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------

A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------gagctccggaggatga--
A0A2K5E6K7_BAD-01       --------------------------------gagctccggaggatgagt
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       gccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaa
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------

A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
A0A2K5E6K7_BAD-01       gacgagtttgtggactcctttaagggacttcctcgcccgaagagcgcggg
A0A2K5E6K7_BAD-02       ----------------------agggacttcctcgcccgaagagcgcggg
A0A2K5E1W9_BMF-02       -----------------------------------------------cat
A0A2K5E1W9_BMF-01       agcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacat
A0A2K5CAB2_BCL2L11      -----------------------------------------------tat
A0A2K5CAB2_BCL2L11      -----------------------------------------------ggc
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      -----------------------------------------------cat
A0A2K5CAB2_BCL2L11      -----------------------------------------------cat
A0A2K5CAB2_BCL2L11      -----------------------------------------------cat
A0A2K5CAB2_BCL2L11      -----------------------------------------------cat
A0A2K5CAB2_BCL2L11      -----------------------------------------------cat
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------

A0A2K5CLG5_BIK-01       -------cccgcaaacaggcagtgctgctggcactcctggcgctgc---t
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
A0A2K5E6K7_BAD-01       cacagcaacgcagatgcggcaaagctccagttggacgcaagtcatccagt
A0A2K5E6K7_BAD-02       cacagcaacgcagatgcggcaaagctccagttggacgcaagtcatccagt
A0A2K5E1W9_BMF-02       cagcagaaccgaaatcgcgtgtggtggcaggtcctcctctttctgcacaa
A0A2K5E1W9_BMF-01       cagcagaaccgaaatcgcgtgtggtggcaggtcctcctctttctgcacaa
A0A2K5CAB2_BCL2L11      ---ttcattg----tggtttagatttatatttacct-------------t
A0A2K5CAB2_BCL2L11      cactgaatcc----tcccttggaattgc---ccttc-------------g
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      gaggcaatct----caggctgaacctgcaggtatgc-------------g
A0A2K5CAB2_BCL2L11      gaggcaatct----caggctgaacctgcaggtatgc-------------g
A0A2K5CAB2_BCL2L11      gaggcaatct----caggctgaacctgcaggtatgc-------------g
A0A2K5CAB2_BCL2L11      gaggcaatct----caggctgaacctgcaggtatgc-------------g
A0A2K5CAB2_BCL2L11      gaggcaatct----caggctgaacctgcaggtatgc-------------g
A0A2K5CAB2_BCL2L11      ----------------gact------------------------------
A0A2K5BYA0_HRK-01       -gcgcggccgcgcaggtggcggcgctggcggcct----------------
A0A2K5F6X4_BBC3-02      -tcctgtacaatctcatcatgggactcctgcccttt-------------c

A0A2K5CLG5_BIK-01       gctggcgatgttcagcg--------ggggtctgcacctgctgctcaagtg
A0A2K5CFK7_PMAIP1-      ------tctgctcaggaacctga---------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
A0A2K5E6K7_BAD-01       cctggt--gggatcggaacttgggcaggggaggctccgctccctcccagt
A0A2K5E6K7_BAD-02       cctggt--gggatcggaacttgggcaggggaggctccgctccctcccagt
A0A2K5E1W9_BMF-02       cctggctttgaatggagaagagaacaggaatggggcag---gcccgag--
A0A2K5E1W9_BMF-01       cctggctttgaatggagaagagaacaggaatggggcag---gcccgaggt
A0A2K5CAB2_BCL2L11      ctttgatttgtatggccaccaccacagtcaaggtacag----aacaactc
A0A2K5CAB2_BCL2L11      taggga--ggttcagtggccacttgagtggt----tagcaaaatcaagct
A0A2K5CAB2_BCL2L11      ---aga--gaaataga------ggaagttgtcgtgtag------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      cccgga--gatatggatcgcccaagagttgcggcgtatcggagacgagtt
A0A2K5CAB2_BCL2L11      cccgga--gatatggatcgcccaagagttgcggcgtatcggagacgagtt
A0A2K5CAB2_BCL2L11      cccgga--gatatggatcgcccaagagttgcggcgtatcggagacgagtt
A0A2K5CAB2_BCL2L11      cccgga--gatatggatcgcccaagagttgcggcgtatcggagacgagtt
A0A2K5CAB2_BCL2L11      cccgga--gatatggatcgcccaagagttgcggcgtatcggagacgagtt
A0A2K5CAB2_BCL2L11      ----------------------------------------gggactag--
A0A2K5BYA0_HRK-01       -----ggctgctcggc-----aggcggaacttg--tag------------
A0A2K5F6X4_BBC3-02      ccaggggccacagagcccccgagatggagcccaattag------------

A0A2K5CLG5_BIK-01       a-------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
A0A2K5E6K7_BAD-01       ga------------------------------------------------
A0A2K5E6K7_BAD-02       gaccttcgctccacatcccgaaactccacccgttcccatcgccttgggcg
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       ga------------------------------------------------
A0A2K5CAB2_BCL2L11      caccac--------------aagtatttctcatga---------------
A0A2K5CAB2_BCL2L11      ga------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------gggtattttt-------gaataa-------
A0A2K5CAB2_BCL2L11      taacgcttattatccaaggagggtattttt-------gaataattaccaa
A0A2K5CAB2_BCL2L11      taacgcttattatccaaggagggtattttt-------gaataattaccaa
A0A2K5CAB2_BCL2L11      taacgcttattatccaaggagggtattttt-------gaataattaccaa
A0A2K5CAB2_BCL2L11      taacgcttattatccaaggaggatatctcttccatctgattga-------
A0A2K5CAB2_BCL2L11      taacgcttattatccaaggaggtta------------gagaaatag----
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------

A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-02       gccatcttggatatgggcggaagtgcttcctgcagggagagctgacccag
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      gcagccgaagaccacccacacatggttatcttacgactgttacgttacat
A0A2K5CAB2_BCL2L11      gcagccgaagaccacccacacatggttatcttacgactgttacgttacat
A0A2K5CAB2_BCL2L11      gcagccgaagaccacccacacatggttatcttacgactgttacgttacat
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------

A0A2K5CLG5_BIK-01       ----------------------------
A0A2K5CFK7_PMAIP1-      ----------------------------
A0A2K5E6K7_BAD-03       ----------------------------
A0A2K5E6K7_BAD-01       ----------------------------
A0A2K5E6K7_BAD-02       attcccttccggtgcgtgtga-------
A0A2K5E1W9_BMF-02       ----------------------------
A0A2K5E1W9_BMF-01       ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      tgtccgcctggtgtggagaatgcattga
A0A2K5CAB2_BCL2L11      tgtccgcctggtgtggagaatgcattga
A0A2K5CAB2_BCL2L11      tgtccgcctggtgtggagaatgcattga
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5BYA0_HRK-01       ----------------------------
A0A2K5F6X4_BBC3-02      ----------------------------

© 1998-2019