Dataset for CDS BCL2L11 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CAB2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CAB2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
                        **************************************************

A0A2K5CAB2_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5CAB2_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5CAB2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CAB2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CAB2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CAB2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CAB2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CAB2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CAB2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CAB2_BCL2L11      cctccctacagacagagccaca----------------------------
                        **********************                            

A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CAB2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CAB2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CAB2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CAB2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CAB2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CAB2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CAB2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CAB2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CAB2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CAB2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CAB2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CAB2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CAB2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CAB2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CAB2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CAB2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CAB2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CAB2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CAB2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CAB2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CAB2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5CAB2_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CAB2_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgata
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggatgagg
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtt----
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CAB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
                        ******************************************        

A0A2K5CAB2_BCL2L11      t---ttcattgtggtttagatttatatttaccttctttgatttgtatggc
A0A2K5CAB2_BCL2L11      ccactgaatcctcccttggaattgc-----ccttcgtagggaggttcagt
A0A2K5CAB2_BCL2L11      ---------------------------------------agagaaataga
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CAB2_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CAB2_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CAB2_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
                                                                          

A0A2K5CAB2_BCL2L11      caccaccacagtcaaggtacagaacaac------------------tcca
A0A2K5CAB2_BCL2L11      ggccacttgagtggt----tagcaaaatcaagctga--------------
A0A2K5CAB2_BCL2L11      ------ggaagttgtcgtgtag----------------------------
A0A2K5CAB2_BCL2L11      -------------------tgactgggactag------------------
A0A2K5CAB2_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CAB2_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CAB2_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CAB2_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
                                                                          

A0A2K5CAB2_BCL2L11      ccacaagtatttctcatga-------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      aggaggatatctct------------------------------------
A0A2K5CAB2_BCL2L11      aggaggtta-----gagaaatag---------------------------
A0A2K5CAB2_BCL2L11      ----gggtatttttgaataa------------------------------
A0A2K5CAB2_BCL2L11      aggagggtatttttgaataattaccaagcagccgaagaccacccacacat
A0A2K5CAB2_BCL2L11      aggagggtatttttgaataattaccaagcagccgaagaccacccacacat
A0A2K5CAB2_BCL2L11      aggagggtatttttgaataattaccaagcagccgaagaccacccacacat
                                                                          

A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      -----------------------------tccatctg-------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      ggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgc
A0A2K5CAB2_BCL2L11      ggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgc
A0A2K5CAB2_BCL2L11      ggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgc
                                                                          

A0A2K5CAB2_BCL2L11      -----
A0A2K5CAB2_BCL2L11      -----
A0A2K5CAB2_BCL2L11      -----
A0A2K5CAB2_BCL2L11      -----
A0A2K5CAB2_BCL2L11      attga
A0A2K5CAB2_BCL2L11      -----
A0A2K5CAB2_BCL2L11      -----
A0A2K5CAB2_BCL2L11      attga
A0A2K5CAB2_BCL2L11      attga
A0A2K5CAB2_BCL2L11      attga
                             

© 1998-2019