Dataset for CDS BAD of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5E6K7_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2K5E6K7_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2K5E6K7_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
                       **************************************************

A0A2K5E6K7_BAD-03      tgcagagaggggcctgagccccagcaccgcaggggacaggcccccaggct
A0A2K5E6K7_BAD-01      tgcagagaggggcctgagccccagcaccgcaggggacaggcccccaggct
A0A2K5E6K7_BAD-02      tgcagagaggggcctgagccccagcaccgcaggggacaggcccccaggct
                       **************************************************

A0A2K5E6K7_BAD-03      ctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcac
A0A2K5E6K7_BAD-01      ctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcac
A0A2K5E6K7_BAD-02      ctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcac
                       **************************************************

A0A2K5E6K7_BAD-03      cagcagggacagccaaccagcagcagccaccatggaggtgagtactccac
A0A2K5E6K7_BAD-01      cagcagggacagccaaccagcagcagccaccatggaggcgc---------
A0A2K5E6K7_BAD-02      cagcagggacagccaaccagcagcagccaccatgg---------------
                       ***********************************               

A0A2K5E6K7_BAD-03      ttgtgcctctgcttcctcatctgagaatcccagtgcaaggatgctctcga
A0A2K5E6K7_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
                                                                         

A0A2K5E6K7_BAD-03      aagcatcagcagggatgtccgccccagccactgactcagaaaatgtaaag
A0A2K5E6K7_BAD-01      ---------------------------------------------tgggg
A0A2K5E6K7_BAD-02      --------------------------------------------------
                                                                         

A0A2K5E6K7_BAD-03      ctggaggtgccttgctgggtcgccacagctcctaccccgcagggacggag
A0A2K5E6K7_BAD-01      ctgtggagacc---cgaagtcgccacagctcctaccccgcagggacggag
A0A2K5E6K7_BAD-02      --------------------------------------------------
                                                                         

A0A2K5E6K7_BAD-03      gaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcg
A0A2K5E6K7_BAD-01      gaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcg
A0A2K5E6K7_BAD-02      --------------------------------------------------
                                                                         

A0A2K5E6K7_BAD-03      ctcagcaccccccaacctctgggcagcacagcgctatggccgcgagctcc
A0A2K5E6K7_BAD-01      ctcagcaccccccaacctctgggcagcacagcgctatggccgcgagctcc
A0A2K5E6K7_BAD-02      --------------------------------------------------
                                                                         

A0A2K5E6K7_BAD-03      ggaggatga-----------------------------------------
A0A2K5E6K7_BAD-01      ggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccg
A0A2K5E6K7_BAD-02      ---------------------------------agggacttcctcgcccg
                                                                         

A0A2K5E6K7_BAD-03      --------------------------------------------------
A0A2K5E6K7_BAD-01      aagagcgcgggcacagcaacgcagatgcggcaaagctccagttggacgca
A0A2K5E6K7_BAD-02      aagagcgcgggcacagcaacgcagatgcggcaaagctccagttggacgca
                                                                         

A0A2K5E6K7_BAD-03      --------------------------------------------------
A0A2K5E6K7_BAD-01      agtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctc
A0A2K5E6K7_BAD-02      agtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctc
                                                                         

A0A2K5E6K7_BAD-03      --------------------------------------------------
A0A2K5E6K7_BAD-01      cctcccagtga---------------------------------------
A0A2K5E6K7_BAD-02      cctcccagtgaccttcgctccacatcccgaaactccacccgttcccatcg
                                                                         

A0A2K5E6K7_BAD-03      --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-02      ccttgggcggccatcttggatatgggcggaagtgcttcctgcagggagag
                                                                         

A0A2K5E6K7_BAD-03      ------------------------------
A0A2K5E6K7_BAD-01      ------------------------------
A0A2K5E6K7_BAD-02      ctgacccagattcccttccggtgcgtgtga
                                                     

© 1998-2018