Dataset for CDS classical BH3-containing proteins of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H9GL49_BMF-01          atggatcctcccggctacttggatgatgacttctcca-ctttggatgggc
R4G9R5_BCL2L11-01      atg--------ctggtcgttggaagcagccagccacagctttg-------
                       ***        * * *  ***** *  * *  *  ** *****       

H9GL49_BMF-01          tggaggatgatgtgttccatgcagaagactgtggacttgccagtcaaccc
R4G9R5_BCL2L11-01      -----------------------------------cttgcttcccaa-ac
                                                          *****    ***  *

H9GL49_BMF-01          agtgagatgacctttcctggcattttcactcagagcaaatcctacaactg
R4G9R5_BCL2L11-01      agctaaatgtcctct--------------------------ctgccaatg
                       **  * *** *** *                          ** * * **

H9GL49_BMF-01          tcttctggggaggttccagctcttcccacttacacactgttgtggccctg
R4G9R5_BCL2L11-01      cttt---------tgctatttcttgctttttataccgtgatgt-------
                         **         * * *  **** *   *** **  ** ***       

H9GL49_BMF-01          gcagtaggcaggccaggcagcaagacaaggcaacacaaacactcaaccca
R4G9R5_BCL2L11-01      -----------gccgtggagaagaacaggg--------------------
                                  ***  * ** *  *** **                    

H9GL49_BMF-01          tcctcttccagccaggatgtgatgttaccttgtggagtcacagaagaacc
R4G9R5_BCL2L11-01      -------------aggagatggtgt---------gag--gcagaa-----
                                    ****  ** ***         ***   *****     

H9GL49_BMF-01          ccagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaa
R4G9R5_BCL2L11-01      --------------------------------------------------

H9GL49_BMF-01          ttggtttctcattgaatccacacttccaggagg-agccccaggagagtcc
R4G9R5_BCL2L11-01      ---------------------acttccagatggcagtcacggccaattcc
                                            ********  ** ** * * *   * ***

H9GL49_BMF-01          acaggaactgcgtactgaagttcagattgcacggaagttgcagtgcattg
R4G9R5_BCL2L11-01      tgaagatatgcagccagaaatatggattgcacaggaattacggcgcatcg
                         * **  ***   * *** *   ******** * * ** * * **** *

H9GL49_BMF-01          cagaccagttccacaggcttcacctacagaggcaccagcagaacagaaac
R4G9R5_BCL2L11-01      gagatgaattcaat--gctt--cccactg---------------------
                        ***  * *** *   ****  ** ** *                     

H9GL49_BMF-01          caggtctggtggcagatcttcttcttcctccataacgtgg--ccttgaac
R4G9R5_BCL2L11-01      ----------------------------tccaagaaggggtttcttggat
                                                   ****  * * **   **** * 

H9GL49_BMF-01          atggaggcaaacagacatcgtgctggccgtagttgtaccacaacctattt
R4G9R5_BCL2L11-01      taccaagcagtaaaccatca----gatcataattttgc------------
                           * ***   *  ****     *  * ** ** * *            

H9GL49_BMF-01          tccttttactgagcctccggtgtgttttccattctctgaaatgctgccaa
R4G9R5_BCL2L11-01      gcctgttac----------------attacattgtccg------------
                        *** ****                 ** **** ** *            

H9GL49_BMF-01          gattctgtctagaggctatc-tga
R4G9R5_BCL2L11-01      --cttcatttggagaatgcagtga
                          *   * * ***  *    ***

© 1998-2019