Dataset for CDS classical BH3-containing proteins of organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1K1C7_BAD-02       atggc---------------------------------------------
A0A3Q1K1C7_BAD-01       atggc---------------------------------------------
A0A3Q1ICY2_BCL2L11      atggatcctagacaaccaaaccgctccgatggctcgacagctgtaacggc
A0A3Q1IPR4_BMF-01       atgga---------------------cgatga------------------
                        ****                                              

A0A3Q1K1C7_BAD-02       ------------agcaaga---------ttcaccatttcagacagcgact
A0A3Q1K1C7_BAD-01       ------------agcaaga---------ttcaccatttcagacagcgact
A0A3Q1ICY2_BCL2L11      cacaggggagagcggaggagacccaccacccgtcggtgccgctggagtct
A0A3Q1IPR4_BMF-01       -------------ggagga-----------------------tgatgtgt
                                     * * **                           *  *

A0A3Q1K1C7_BAD-02       cagaccca----------------tcagaggg------------------
A0A3Q1K1C7_BAD-01       cagaccca----------------tcagaggg------------------
A0A3Q1ICY2_BCL2L11      caacgccaacctcccgttcgaacgacggcggggagcggaggtttggccgc
A0A3Q1IPR4_BMF-01       ttgagccagaccccc---------actgctgg---------------cgt
                             ***                 * *  **                  

A0A3Q1K1C7_BAD-02       ---------gatggaggaagaaggacacaaccagtcaccaccaggg----
A0A3Q1K1C7_BAD-01       ---------gatggaggaagaaggacacaaccagtcaccaccaggg----
A0A3Q1ICY2_BCL2L11      cctgactccagtggaggaggagagcctgaatcg--cagtcccggtgcaga
A0A3Q1IPR4_BMF-01       accacattcag-ggagataaagtgtcaaga----------ccggggca--
                                    ****    *  * *   *          ** * *    

A0A3Q1K1C7_BAD-02       --caagagcagcaagtttttccacgccacacccttacct-taccggaact
A0A3Q1K1C7_BAD-01       --caagagcagcaagtttttccacgccacacccttacct-taccggaact
A0A3Q1ICY2_BCL2L11      accaaaagtagctcgtcttccgacggcctaggcgtgtttaggtcagtatt
A0A3Q1IPR4_BMF-01       --cacagacacctggccctgcgctgccacaga-------acaacggcatg
                          **     * *  *   * *   * *  *             * * *  

A0A3Q1K1C7_BAD-02       cagagct---------------agtgg----------------------t
A0A3Q1K1C7_BAD-01       cagagct---------------agtgg----------------------t
A0A3Q1ICY2_BCL2L11      ccgcctcccccggcgctcctctagtggatatttctcctacgacagtgact
A0A3Q1IPR4_BMF-01       ctgccct----------------gtggag--------------------t
                        * *                    ****                      *

A0A3Q1K1C7_BAD-02       cgaatcaggctgaactcag---------------------agtctcacgc
A0A3Q1K1C7_BAD-01       cgaatcaggctgaactcag---------------------agtctcacgc
A0A3Q1ICY2_BCL2L11      cgca----gccgagctccccgctctcacctaggccagtgacgtttgacag
A0A3Q1IPR4_BMF-01       cgca----gaggagcccagaccactcttctacggcaacgcaggttttcgg
                        ** *    *  ** * *                        *  *  *  

A0A3Q1K1C7_BAD-02       ttccaccgtct-acaga-------------------gacgaagaact---
A0A3Q1K1C7_BAD-01       ttccaccgtct-acaga-------------------gacgaagaact---
A0A3Q1ICY2_BCL2L11      agccac------gcagactccgagccccaccggccaggtgatgaaccacg
A0A3Q1IPR4_BMF-01       ttgcacttcccagcacacttcgagctt---------gttgggga------
                           ***       ** *                   *  *  **      

A0A3Q1K1C7_BAD-02       ----------------ccaggc---caaggcaga--tgaggaagctggta
A0A3Q1K1C7_BAD-01       ----------------ccaggc---caaggcaga--tgaggaagctggta
A0A3Q1ICY2_BCL2L11      ccctgcagcgcttggccgaggcgaacggctcagacctgaggacgcatcag
A0A3Q1IPR4_BMF-01       tctggaag--------tgaggc-aacaagacag---tgaggagg----aa
                                          ****   *    ***   ****** *      

A0A3Q1K1C7_BAD-02       cgcccacagatggagctcc------attcagggcacggtccaagtctgct
A0A3Q1K1C7_BAD-01       cgcccacagatggagctcc------attcagggcacggtccaagtctgct
A0A3Q1ICY2_BCL2L11      cagcacggaa--gcgatctcagctcctctagcacgcag--caacaaaacg
A0A3Q1IPR4_BMF-01       caaaacgggatggagatcccaccc-----------cgg--caacaa----
                        *        *  * * **                 * *  ***       

A0A3Q1K1C7_BAD-02       ccaccagccctgtgggcagcaaagaaata-----cggccagcagctcaga
A0A3Q1K1C7_BAD-01       ccaccagccctgtgggcagcaaagaaata-----cggccagcagctcaga
A0A3Q1ICY2_BCL2L11      cagcaggggatatgcaggcagtggaagtc------ggacgagagctccga
A0A3Q1IPR4_BMF-01       ccactg-----atgcaaagcgtggaagcctgtattggccagaaactccag
                        *  *        **         ***         ** *   * ***   

A0A3Q1K1C7_BAD-02       agaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaa
A0A3Q1K1C7_BAD-01       agaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaa
A0A3Q1ICY2_BCL2L11      cgcattggagacgacttcaataacc-acctcctggaggtggcaggcagac
A0A3Q1IPR4_BMF-01       ctaataggagaccagtttcacagag-aacacctacaactgt------atc
                           **  * *** * **  * *             *   *          

A0A3Q1K1C7_BAD-02       ggtgaggagcgctggcacggccag------------------acagatgc
A0A3Q1K1C7_BAD-01       ggtgaggagcgctggcacggccag------------------acagatgc
A0A3Q1ICY2_BCL2L11      atagatgggtggggatccaaccaatccgattaccacatatccaccaggac
A0A3Q1IPR4_BMF-01       atcga-------------aaccaa--------------aggaaccaggg-
                           **               ***                   **      

A0A3Q1K1C7_BAD-02       accactct---------------aagagctggtggagctacctctt--ta
A0A3Q1K1C7_BAD-01       accactct---------------aagagctggtggagctacctctt--ta
A0A3Q1ICY2_BCL2L11      cccactgt-------cct-------gctctgcgtgggcctcctgctcttt
A0A3Q1IPR4_BMF-01       cccgctgtggtggcgcctggccgcagctatgc-tcagcctcctgtt----
                         ** ** *                 *   **     **  ***  *    

A0A3Q1K1C7_BAD-02       gtcaccaggagactga------gggagagaacaatcaccacgaa-agcca
A0A3Q1K1C7_BAD-01       gtcaccaggagactga------gggagagaacaatcaccacgaa-agcca
A0A3Q1ICY2_BCL2L11      gtgattggacggataatctact------cgcaaggcagtacgaacagcga
A0A3Q1IPR4_BMF-01       -tgacagg--ggattaattgctggaggaggcggagcaggacgga-ggtga
                         * *   *  *  * *                   **  *** *  *  *

A0A3Q1K1C7_BAD-02       cacacaccgcactgagtag
A0A3Q1K1C7_BAD-01       cacacaccgcactgagtag
A0A3Q1ICY2_BCL2L11      gggccactctcacgtttag
A0A3Q1IPR4_BMF-01       -------------------
                                           

© 1998-2019