Dataset for CDS classical BH3-containing proteins of organism Amphiprion percula

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8RLE2_BCL2L11      gcgaac--------agaacacctagtttagtaggacctgaacagaagaag
A0A3P8RKY9_BMF-01       atggacgatgaggaggatgatgtttttgagccagacccccactgctggcg
A0A3P8TWH6_BAD-01       atggctgc-----aaaattcactatttcagacag-----------cgagt
                          *             *     *  ** **   *            *   

A0A3P8RLE2_BCL2L11      aggaacggagggaacctcagaggcggcggagcagatccagaac-------
A0A3P8RKY9_BMF-01       cacaac--------attcag-ggagat---aaagtgtgaagac-------
A0A3P8TWH6_BAD-01       cagagc--------catcagaggaggtagaagagggagaaaacaaccatt
                           * *          **** ** *       **    *  **       

A0A3P8RLE2_BCL2L11      --ccgtcggtgcagctggggtct--------cggcgaaaacatcccgttt
A0A3P8RKY9_BMF-01       --cggggcacacagact---cctggtcctgcc--ctgcaaccaaacaacg
A0A3P8TWH6_BAD-01       caccagcaacacaagccatgcctgttttcgcccgccgcaac------atg
                          *        **        **        *  *   ***         

A0A3P8RLE2_BCL2L11      gaa--ctccact----------ggaggagagccggactccccgtcctggt
A0A3P8RKY9_BMF-01       gcatgctgccctgtggagtcgcagaggagcccagaccactcttctacggt
A0A3P8TWH6_BAD-01       gc---cttacct--------------gaactcagaactccagcatctggt
                        *    **   **              **   * *  * *        ***

A0A3P8RLE2_BCL2L11      ccagagcgcaggccagcctaggcgtgtttcagaccaggtcgatttttcac
A0A3P8RKY9_BMF-01       ----aacgcaggtt---ttcgact----------------------gcac
A0A3P8TWH6_BAD-01       c---ggctcaggctgaactcggag----------------------tccc
                              * ****      * *                          * *

A0A3P8RLE2_BCL2L11      ctccctcgccgctcctccagtggctatttctccgccgatggtgccgactc
A0A3P8RKY9_BMF-01       ttcccagcacgct-tt---gagcttat-----------------------
A0A3P8TWH6_BAD-01       acgcctccacgct-ctccagaga---------------------------
                           **    ****  *   * *                            

A0A3P8RLE2_BCL2L11      ggtgccgagctccccgctctcaccgaagcgactgacggc--------tga
A0A3P8RKY9_BMF-01       --tgggaatcaccaagcaaggcaacaaggaagtg-------------aaa
A0A3P8TWH6_BAD-01       --tgaggagctccaggcgaggggggaagaggaagccggcacgcccacaga
                          **   * * **  **        ***     *               *

A0A3P8RLE2_BCL2L11      caaagc--cacgcagactccgagcccgagcggccaggtgatcaaacacgc
A0A3P8RKY9_BMF-01       tggagc---------aaaatgggatggagcagct-------------gcc
A0A3P8TWH6_BAD-01       cggagctccgttcagggcacggtccaagtcggct-------------ccc
                           ***              *        * **                *

A0A3P8RLE2_BCL2L11      gctggagcgcatgaccgatgaggcgcacggaggag---------gaccgg
A0A3P8RKY9_BMF-01       ccggcagc----aacctgtggcacgtagcatggaggcttgcattggacag
A0A3P8TWH6_BAD-01       cctgca---------ctgtgggccgc--caagaag---tac---ggccag
                         * * *         *  **   **      * **         *  * *

A0A3P8RLE2_BCL2L11      gaacgcagcagcacggtgagctcaggctgaca---------------tac
A0A3P8RKY9_BMF-01       aaactccagctgatag-gagaccagtttcaccgggaacacctacaactgt
A0A3P8TWH6_BAD-01       cagcttcgaaggatga-gcgatgagtttgacag------cctgcta-gat
                         * *        *    * *   **  * **                   

A0A3P8RLE2_BCL2L11      acgagggaaatcagttgcacattcaatctctgcaatagtttttgcac---
A0A3P8RKY9_BMF-01       atcatcgaaaccaaaggaaccaggggccgctgtggtggcgcctggccgca
A0A3P8TWH6_BAD-01       aaaggggagatgaagagggtgaggag----tgcagggacagccagacaga
                        *     ** *  *   *             **              *   

A0A3P8RLE2_BCL2L11      ---gctgttttctgtcactgttttctgtcatcttcagtcgctgtttgcgt
A0A3P8RKY9_BMF-01       ---gccgttctcag---------------ccttctgtttgacagggggtt
A0A3P8TWH6_BAD-01       tgcaccactctaaaagctggtggagctacctctttagtcaccaggaga--
                            *   * *                     *    *        *   

A0A3P8RLE2_BCL2L11      ctacgctacaaaacgtcttgattaggtttattaacccaaactacttcagt
A0A3P8RKY9_BMF-01       cattgctggaggaggt---------------------g----------gt
A0A3P8TWH6_BAD-01       ------tggagggaga---------------------gaacaaccaccat
                              *  *    *                                  *

A0A3P8RLE2_BCL2L11      acattttgga------aaagatgttaa
A0A3P8RKY9_BMF-01       gcaggacgga------------ggtga
A0A3P8TWH6_BAD-01       gaaagccacacacatcgcaatgagtag
                          *      *              *  

© 1998-2019