Dataset for CDS classical BH3-containing proteins of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1LIZ7_PMAIP1-01       atgc----------------------------------------------
G1LDR8_BCL2L11-01      atgg------caaagcaaccttcagatgt---------------------
G1MI17_BAD-01          gtggggaccccagagaatccctcatctgctcccacacatggcccaggcaa

G1LIZ7_PMAIP1-01       -----------------------------ctgggaagaaagcgcgtaaga
G1LDR8_BCL2L11-01      ----aagt----------tctgagtgtgacagagaaggt-----ggacaa
G1MI17_BAD-01          aaggaagtcgggaactgatcggcgggagacgaggaagggacccaggacga
                                                    *   ****       * *  *

G1LIZ7_PMAIP1-01       gcgc----------------------------------------------
G1LDR8_BCL2L11-01      ctgcagcctgctgagaggcctcctcagctcag-----gcctggggcccct
G1MI17_BAD-01          ccgc-gctt--------gcccccacagcccagagcatgttccagatccca

G1LIZ7_PMAIP1-01       -----------------gcagg------cgagtcctg-------------
G1LDR8_BCL2L11-01      acctctctacagacagagcagcaagg---taatcctgaaggcgaagg---
G1MI17_BAD-01          gagtttgagcccagtgagcaggaagactccagccctgcagataggggcct
                                        ****         *  ****             

G1LIZ7_PMAIP1-01       ----cgcggaccc----ggggtcagccc----------------------
G1LDR8_BCL2L11-01      ggaccgctgcccccaagg----cagccctcagggccc-gctggccccacc
G1MI17_BAD-01          gggccccagccccacaggggaccagcccccaggccctggcaagcaccggc
                           * * * ***    *    ******                      

G1LIZ7_PMAIP1-01       --------------------------------------------------
G1LDR8_BCL2L11-01      agccagcccaggcccttttgctaccagatccccgcttttcatctttgtga
G1MI17_BAD-01          agacagcc---------------ccaggcctcc------------taggg

G1LIZ7_PMAIP1-01       gaag----------------------------------------------
G1LDR8_BCL2L11-01      gaagatcctc-cctgctgtctcgatcctccagtgggtatttctcttttga
G1MI17_BAD-01          gaagctgctcacccccaggggcagccggccagcagcaaccaccatggagg

G1LIZ7_PMAIP1-01       --------------------------------------------------
G1LDR8_BCL2L11-01      cacagacaggagcccggcacccatgagttgtgacaaatcaacacaaaccc
G1MI17_BAD-01          cgctg---gggctgtggagccccggagtcgccacagctcg----------

G1LIZ7_PMAIP1-01       --------------------------------------------------
G1LDR8_BCL2L11-01      caagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcc
G1MI17_BAD-01          ------taccccgcggggaccgaag----------aggatgaagggttgg

G1LIZ7_PMAIP1-01       --------------------------------------------------
G1LDR8_BCL2L11-01      atgaggcag-tctcaggctgtacctg------ccgatat--gcgcccgga
G1MI17_BAD-01          aggaggaagagctcagccctttccgggggcgctcgagctcagcgcccccc

G1LIZ7_PMAIP1-01       -----------tggagtgcgccatt-----caactcaggagatttggaga
G1LDR8_BCL2L11-01      gat-------atggattgcgcaa-------gagttgcggcgtattggaga
G1MI17_BAD-01          aacctctgtgctgcactgcgctatggccgcgagctccggaggatgagcga
                                  ** * ***** *        *  *  ** *  *  * **

G1LIZ7_PMAIP1-01       caaact---------------------gaatttccg-----gcaga----
G1LDR8_BCL2L11-01      cgaatttaatgcatattacccaaggagggtctttct-----gaata----
G1MI17_BAD-01          cgagttccagggctccttc-----aagggacttcctcgcccgaagagcgc
                       * *  *                     *   ** *      * * *    

G1LIZ7_PMAIP1-01       -----------aacttctgaatctgatatccaaac---------------
G1LDR8_BCL2L11-01      ----attaccaagcagccgaagcccacccccaaatgattatcttgcgact
G1MI17_BAD-01          gggcacagcgacgcagatgcgacaaagccccagctgg-------------
                                    *    *   *  *   ***                  

G1LIZ7_PMAIP1-01       -----------tcttccgctc----------aggaacc------------
G1LDR8_BCL2L11-01      gttacgttacatcgtccg--cctggtg----tggagattg----------
G1MI17_BAD-01          ---acg-cgcgtcatccagtcctggtgggatcggaacttggggagaggag
                                  ** ***   *           ***               

G1LIZ7_PMAIP1-01       --------------------
G1LDR8_BCL2L11-01      --------------cagtga
G1MI17_BAD-01          gctccgccccctcccaatga

© 1998-2019